Hemp is a unique plant in that it can produce both male and female flowers. To understand how hemp produces female seeds, it is important to first understand the basics of hemp sex determination. Hemp plants are identified by their nodes, which are the areas where leaves and branches grow from the stem. Male plants contain pollen sacs, while female plants contain the stigma, which traps pollen.
Male plants do not contain seeds, but they do have pollen sacs that pollinate female plants and initiate seed production. Once the pollen sacs begin to bloom, these plants are returned to the room with the healthy female plants and placed on tables at a slightly higher level. When a bud of a hemp flower is pollinated, it immediately begins to devote its energy to producing hemp seeds. In comparison, the seeds obtained from hermaphroditic inflorescences of the “Moby Dyck” and “Space Queen” strains produced seedlings that all showed the 540 bps band size corresponding to the female phenotype (Figures 10D, E); the 390 bps band specific to males was absent. After 72 hours, tissue samples were prepared for scanning electron microscopy and the production of germ tubes and growth was determined in the stigmas that pierced the receptive papillae with several magnifications starting from a minimum of 25 images. In three female strains —Moby Dick, Space Queen and Copenhagen Kush—, the primers S22645strt (5′ CCAATAACCCCTCATTCC3′) and S22645end (5′ ATTTCCAAAAGTGTGCGATTCC3′) primers were used to amplify beyond the region of the ∼540 bps female band. The male and female subpopulations of Salix viminalis have high genetic diversity and high rates of long-term migration between them.
In commercial production, all marijuana plants are genetically female; male plants are destroyed as seed formation reduces flower quality. When stressed, female hemp plants can become hermaphrodites and produce female buds and male pollen on the same plant. Alignment of PCR fragment sequences from female and male Cannabis sativa plants corresponding to the 540 bps band in female strains (F), the 540 bps band in male strains (M-L) and the 390 bp band in male strains (M-s). When hermaphrodites were used as pollen donors, the proportion of pups by sex that they produced through crosses was biased towards females. Microscopic scanning electron examination of anthers produced in staminated plants showed the release of pollen grains (Figure 6G).
Growers will save time (and money) if they plant quality, well-cultivated and properly feminized hemp seeds. However, in a third strain, “Healer”, which were seeds obtained from outdoor marijuana cultivation, only two male plants were identified among 16 plants; the remaining 14 were female (Figure 10C). The seeds were removed and placed in a humid potting medium where they germinated at a rate of 90— 95% in 10 to 14 days to produce seedlings (Figures 9C, D). A self-fertilization cycle, which is the result of hermaphroditic seed production until self-fertilization, may not have caused a measurable difference due to the high level of heterozygosity predicted in C.
Leave Reply